Templates

Molecular Biology

Preview

Molecular Biology

Molecular biology research paper template with CRISPR/gene editing structure. Includes mhchem for chemical formulas, siunitx for SI units, data tables, and standard Methods/Results format for wet lab research.

Category

Academic

License

Free to use (MIT)

File

molecular-biology/main.tex

main.texRead-only preview
\documentclass[11pt,a4paper]{article}

% Packages for molecular biology
\usepackage[utf8]{inputenc}
\usepackage[T1]{fontenc}
\usepackage{amsmath,amssymb}
\usepackage{graphicx}
\usepackage{booktabs}
\usepackage{hyperref}
\usepackage{xcolor}
\usepackage[margin=1in]{geometry}
\usepackage{natbib}
\usepackage{siunitx}
\usepackage{textgreek}
\usepackage{mhchem}  % Chemical formulas
\usepackage{longtable}
\usepackage{multirow}
\usepackage{float}

% Define colors
\definecolor{dnaA}{RGB}{255,99,71}   % Adenine - Red
\definecolor{dnaT}{RGB}{50,205,50}   % Thymine - Green
\definecolor{dnaG}{RGB}{30,144,255}  % Guanine - Blue
\definecolor{dnaC}{RGB}{255,215,0}   % Cytosine - Yellow

\title{CRISPR-Cas9 Mediated Gene Editing:\\Efficiency and Off-Target Analysis in Human Cell Lines}
\author{%
  First Author\textsuperscript{1,*}, Second Author\textsuperscript{2}, Third Author\textsuperscript{1,3}\\[1em]
  \textsuperscript{1}Department of Molecular Biology, University of Science\\
  \textsuperscript{2}Institute of Genetics, Research Hospital\\
  \textsuperscript{3}Center for Gene Therapy, Medical School\\[0.5em]
  \textsuperscript{*}Corresponding author: \texttt{first.author@science.edu}
}
\date{\today}

\begin{document}

\maketitle

\begin{abstract}
Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9 has revolutionized genome editing, yet concerns about off-target effects remain. We systematically evaluated editing efficiency and specificity across 15 guide RNAs targeting the \textit{TP53} tumor suppressor gene in HEK293T and HeLa cell lines. Using GUIDE-seq and targeted deep sequencing, we identified off-target sites and quantified editing frequencies. Our results demonstrate that high on-target efficiency (\textgreater 85\%) can be achieved while minimizing off-target activity through optimized guide RNA design and delivery protocols. We provide a framework for assessing CRISPR safety that will facilitate clinical translation of gene editing therapies.
\end{abstract}

\textbf{Keywords:} CRISPR-Cas9, gene editing, off-target effects, guide RNA, next-generation sequencing

\section{Introduction}

The CRISPR-Cas9 system has emerged as the most versatile tool for precise genome editing \citep{doudna2014crispr}. The system consists of two key components:

\begin{itemize}
  \item \textbf{Cas9 nuclease}: Creates double-strand breaks (DSBs) in DNA
  \item \textbf{Guide RNA (gRNA)}: Directs Cas9 to specific genomic loci through base-pairing
\end{itemize}

The efficiency of editing depends on the protospacer adjacent motif (PAM), typically 5'-NGG-3' for \textit{Streptococcus pyogenes} Cas9 (SpCas9).

\subsection{Study Objectives}

\begin{enumerate}
  \item Characterize editing efficiency across multiple gRNA designs
  \item Identify and quantify off-target editing events
  \item Establish guidelines for safe CRISPR application
\end{enumerate}

\section{Materials and Methods}

\subsection{Cell Culture}

HEK293T and HeLa cells were maintained in DMEM supplemented with 10\% FBS and 1\% penicillin-streptomycin at \SI{37}{\celsius} with 5\% \ce{CO2}.

\subsection{Guide RNA Design}

We designed 15 gRNAs targeting exons 4-8 of the \textit{TP53} gene (Table~\ref{tab:grnas}). Off-target prediction was performed using Cas-OFFinder \citep{bae2014casoffinder}.

\begin{table}[H]
\centering
\caption{Guide RNA sequences targeting \textit{TP53}.}
\label{tab:grnas}
\begin{tabular}{@{}llc@{}}
\toprule
\textbf{gRNA ID} & \textbf{Target Sequence (5' $\to$ 3')} & \textbf{Exon} \\
\midrule
TP53-g1 & \texttt{GCAGTCACAGCACATGACGG} & 4 \\
TP53-g2 & \texttt{TGAAGCTCCCAGAATGCCAG} & 4 \\
TP53-g3 & \texttt{CCATTGTTCAATATCGTCCG} & 5 \\
TP53-g4 & \texttt{ACTGGGACGGAACAGCTTTG} & 5 \\
TP53-g5 & \texttt{GCTGCTCAGATAGCGATGGT} & 6 \\
\bottomrule
\end{tabular}
\end{table}

\subsection{Transfection and Editing}

Cells were transfected with Cas9 protein and gRNA using Lipofectamine 3000 according to manufacturer's protocol:

\begin{enumerate}
  \item Prepare Cas9-gRNA ribonucleoprotein (RNP) complex
  \item Mix with Lipofectamine in Opti-MEM
  \item Add to cells at 70\% confluency
  \item Harvest cells at 48-72 hours post-transfection
\end{enumerate}

\subsection{Analysis Methods}

\subsubsection{T7 Endonuclease I Assay}

Indel frequencies were initially assessed using T7EI cleavage:
\begin{equation}
  \text{Indel \%} = 100 \times \left(1 - \sqrt{1 - f_{cut}}\right)
\end{equation}
where $f_{cut}$ is the fraction of cleaved DNA.

\subsubsection{Next-Generation Sequencing}

Targeted amplicon sequencing was performed on Illumina MiSeq with paired-end 250 bp reads. Editing outcomes were analyzed using CRISPResso2 \citep{clement2019crispresso2}.

\section{Results}

\subsection{On-Target Editing Efficiency}

All gRNAs demonstrated measurable editing activity (Figure~\ref{fig:efficiency}). Efficiency ranged from 23.4\% (TP53-g12) to 91.2\% (TP53-g3).

% Placeholder for figure
\begin{figure}[H]
\centering
\fbox{\parbox{0.85\textwidth}{\centering\vspace{3cm}[On-Target Editing Efficiency Bar Chart]\vspace{3cm}}}
\caption{On-target editing efficiency across 15 gRNAs in HEK293T cells. Error bars represent SD from three independent experiments.}
\label{fig:efficiency}
\end{figure}

\subsection{Editing Outcomes}

Analysis of indel patterns revealed predominantly small deletions:

\begin{table}[H]
\centering
\caption{Distribution of editing outcomes for top-performing gRNAs.}
\begin{tabular}{@{}lccc@{}}
\toprule
\textbf{gRNA} & \textbf{Insertions} & \textbf{Deletions} & \textbf{Substitutions} \\
\midrule
TP53-g1 & 12.3\% & 74.5\% & 13.2\% \\
TP53-g3 & 8.7\% & 82.1\% & 9.2\% \\
TP53-g5 & 15.1\% & 71.8\% & 13.1\% \\
\bottomrule
\end{tabular}
\end{table}

\subsection{Off-Target Analysis}

GUIDE-seq identified potential off-target sites. Validation by deep sequencing confirmed editing at:

\begin{itemize}
  \item 3 sites for TP53-g1 (0.1-2.3\% frequency)
  \item 1 site for TP53-g3 (0.05\% frequency)
  \item 5 sites for TP53-g7 (0.2-4.1\% frequency)
\end{itemize}

\subsection{Cell Line Comparison}

Editing efficiency was consistent between cell lines:

\begin{equation}
  \text{Correlation coefficient } r = 0.94 \quad (p < 0.001)
\end{equation}

\section{Discussion}

Our comprehensive analysis reveals several key findings:

\begin{enumerate}
  \item GC content correlates with efficiency: optimal range 40-60\%
  \item Mismatches in seed region (positions 1-12) significantly reduce off-target editing
  \item High-fidelity Cas9 variants further improve specificity
\end{enumerate}

\subsection{Clinical Implications}

For therapeutic applications, we recommend:
\begin{itemize}
  \item Selecting gRNAs with \textless 3 predicted off-target sites
  \item Validating specificity using unbiased methods (GUIDE-seq, CIRCLE-seq)
  \item Using RNP delivery to minimize sustained Cas9 expression
\end{itemize}

\section{Conclusion}

We have established a framework for evaluating CRISPR-Cas9 editing efficiency and specificity. Our data support the feasibility of achieving high on-target activity while maintaining acceptable off-target profiles for clinical gene therapy applications.

\section*{Data Availability}

Sequencing data are deposited in NCBI SRA under accession PRJNA000000.

\section*{Acknowledgments}

We thank the core sequencing facility for technical support.

\section*{Funding}

This work was supported by NIH grants R01-GM123456 and K99-CA789012.

\bibliographystyle{plainnat}
\bibliography{references}

\end{document}
Bibby Mascot

PDF Preview

Create an account to compile and preview

Molecular Biology LaTeX Template | Bibby